pcag smfp v5 (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
pcag smfp v5
Pcag Smfp V5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcag+smfp+v5/pCAG_smFP+V5+(Plasmid+%2359758)/pm41904125-265-40-47
Average 93 stars, based on 13 article reviews
Pcag Smfp V5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcag+smfp+v5/pCAG_smFP+V5+(Plasmid+%2359758)/pm41904125-265-40-47
Average 93 stars, based on 13 article reviews
pcag smfp v5 - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Regionally mapped astrocytic responses to cortical and white matter stroke show differential roles in astrocyte-induced vascular remodeling. Article Snippet: Article Regionally mapped astrocytic responses to cortical and white matter stroke show differential roles in astrocyte-induced vascular remodeling Article Title: Astrocyte morphogenesis requires self-recognition. Article Snippet: Self-recognition is a fundamental cellular process across evolution and forms the basis of neuronal self-avoidance.. Clustered protocadherin (cPcdh) proteins, which comprise a large family of isoform-specific homophilic recognition molecules, have a pivotal role in the neuronal self-avoidance that is required for mammalian brain development.. The probabilistic expression of different cPcdh isoforms confers unique identities on neurons and forms the basis for neuronal processes to discriminate between self and non-self. Article Title: Investigating morphological and cytoskeletal dynamics of hippocampal astrocyte across progressive tauopathy Article Snippet: .. WPRE primers: fwd, GGCTGTTGGGCACTGACAAT; rev, CCGAAGGGACGTAGCAGAAG. pUCmini-iCAPPHP.eB was a gift from Viviana Gradinaru (Addgene plasmid # 103005 ; http://n2t.net/addgene:103005 ; RRID:Addgene_103005). Article Title: Antibodies to PfGARP kill Article Snippet: .. To add spaghetti monster V5 46 for 3′ tagging the coding sequence from Article Title: Astrocyte morphogenesis requires self-recognition Article Snippet: .. To generate GfaABC 1 D .Lck-smV5 and Lck-smMyc plasmids, cytosolic smFP-V5 and smFP-Myc DNA sequences were amplified by PCR from the Article Title: Astrocyte morphogenesis requires self-recognition Article Snippet: .. Plasmids and AAVs To generate GfaABC1D.Lck-smV5 and Lck-smMyc plasmids, cytosolic smFP-V5 and smFP-Myc DNA sequences were ampli ed by PCR from the Bioprocessing:Article Title: Regionally mapped astrocytic responses to cortical and white matter stroke show differential roles in astrocyte-induced vascular remodeling. Article Snippet: Article Regionally mapped astrocytic responses to cortical and white matter stroke show differential roles in astrocyte-induced vascular remodeling Amplification:Article Title: Astrocyte morphogenesis requires self-recognition. Article Snippet: Self-recognition is a fundamental cellular process across evolution and forms the basis of neuronal self-avoidance.. Clustered protocadherin (cPcdh) proteins, which comprise a large family of isoform-specific homophilic recognition molecules, have a pivotal role in the neuronal self-avoidance that is required for mammalian brain development.. The probabilistic expression of different cPcdh isoforms confers unique identities on neurons and forms the basis for neuronal processes to discriminate between self and non-self. Article Title: Antibodies to PfGARP kill Article Snippet: .. To add spaghetti monster V5 46 for 3′ tagging the coding sequence from Article Title: Astrocyte morphogenesis requires self-recognition Article Snippet: .. To generate GfaABC 1 D .Lck-smV5 and Lck-smMyc plasmids, cytosolic smFP-V5 and smFP-Myc DNA sequences were amplified by PCR from the Polymerase Chain Reaction:Article Title: Astrocyte morphogenesis requires self-recognition. Article Snippet: Self-recognition is a fundamental cellular process across evolution and forms the basis of neuronal self-avoidance.. Clustered protocadherin (cPcdh) proteins, which comprise a large family of isoform-specific homophilic recognition molecules, have a pivotal role in the neuronal self-avoidance that is required for mammalian brain development.. The probabilistic expression of different cPcdh isoforms confers unique identities on neurons and forms the basis for neuronal processes to discriminate between self and non-self. Article Title: Astrocyte morphogenesis requires self-recognition Article Snippet: .. To generate GfaABC 1 D .Lck-smV5 and Lck-smMyc plasmids, cytosolic smFP-V5 and smFP-Myc DNA sequences were amplified by PCR from the Article Title: Astrocyte morphogenesis requires self-recognition Article Snippet: .. Plasmids and AAVs To generate GfaABC1D.Lck-smV5 and Lck-smMyc plasmids, cytosolic smFP-V5 and smFP-Myc DNA sequences were ampli ed by PCR from the Cloning:Article Title: A bridge-like lipid transfer protein is critical for generation of invasive stages in malaria parasites. Article Snippet: Other plasmids used for transfections in this work, mCh-FRBminiTurbo, GRASP1-mCh and pLyn-FRB-mCh-nmd3-BSD (Addgene #85796) were generated by previous studies32,73. .. Used as templates or backbones for further cloning reactions, pSLI-N-GFP-2xFKBP-loxP (Addgene #85792), pSLI-C-GFP-Sandwich (also pSLI-sandwich, Addgene #85790), pSLI-C-mNG-Sandwich (same as addgene #85792 with mNG replacing GFP), pSkipFlox (Addgene #85797), mScRab6__NLS-FRB, Sf3A2__mCh-Kelch13, pLyn-FRB-mCh-nmd3-BSD (Addgene #85796), were previously generated in our laboratory32,33, Article Title: A bridge-like lipid transfer protein is critical for generation of invasive stages in malaria parasites Article Snippet: Other plasmids used for transfections in this work, mCh-FRB-miniTurbo, GRASP1-mCh and pLyn-FRB-mCh-nmd3-BSD (Addgene #85796) were generated by previous studies , . .. Used as templates or backbones for further cloning reactions, pSLI-N-GFP-2xFKBP-loxP (Addgene #85792), pSLI-C-GFP-Sandwich (also pSLI-sandwich, Addgene #85790), pSLI-C-mNG-Sandwich (same as addgene #85792 with mNG replacing GFP), pSkipFlox (Addgene #85797), mSc-Rab6__NLS-FRB, Sf3A2__mCh-Kelch13, pLyn-FRB-mCh-nmd3-BSD (Addgene #85796), were previously generated in our laboratory , , Generated:Article Title: A bridge-like lipid transfer protein is critical for generation of invasive stages in malaria parasites. Article Snippet: Other plasmids used for transfections in this work, mCh-FRBminiTurbo, GRASP1-mCh and pLyn-FRB-mCh-nmd3-BSD (Addgene #85796) were generated by previous studies32,73. .. Used as templates or backbones for further cloning reactions, pSLI-N-GFP-2xFKBP-loxP (Addgene #85792), pSLI-C-GFP-Sandwich (also pSLI-sandwich, Addgene #85790), pSLI-C-mNG-Sandwich (same as addgene #85792 with mNG replacing GFP), pSkipFlox (Addgene #85797), mScRab6__NLS-FRB, Sf3A2__mCh-Kelch13, pLyn-FRB-mCh-nmd3-BSD (Addgene #85796), were previously generated in our laboratory32,33, Article Title: A bridge-like lipid transfer protein is critical for generation of invasive stages in malaria parasites Article Snippet: Other plasmids used for transfections in this work, mCh-FRB-miniTurbo, GRASP1-mCh and pLyn-FRB-mCh-nmd3-BSD (Addgene #85796) were generated by previous studies , . .. Used as templates or backbones for further cloning reactions, pSLI-N-GFP-2xFKBP-loxP (Addgene #85792), pSLI-C-GFP-Sandwich (also pSLI-sandwich, Addgene #85790), pSLI-C-mNG-Sandwich (same as addgene #85792 with mNG replacing GFP), pSkipFlox (Addgene #85797), mSc-Rab6__NLS-FRB, Sf3A2__mCh-Kelch13, pLyn-FRB-mCh-nmd3-BSD (Addgene #85796), were previously generated in our laboratory , , Sequencing:Article Title: Antibodies to PfGARP kill Article Snippet: .. To add spaghetti monster V5 46 for 3′ tagging the coding sequence from Clone Assay:Article Title: Antibodies to PfGARP kill Article Snippet: .. To add spaghetti monster V5 46 for 3′ tagging the coding sequence from |